European Journal of Pharmacology 

Scutellarin ameliorates colitis-associated colorectal cancer by suppressing Wnt/β-catenin signaling cascade

Sha Zeng a, Li Chen a, Qiang Sun a, Hui Zhao a, Han Yang a, Shan Ren a, Maolun Liu a,
Xianli Meng b, Haibo Xu a,*
a State Key Laboratory of Southwestern Chinese Medicine Resources, Department of Pharmacology, Chengdu University of Traditional Chinese Medicine, Chengdu, 611137, China
b State Key Laboratory of Southwestern Chinese Medicine Resources, Innovative Institute of Chinese Medicine and Pharmacy, Chengdu University of Traditional Chinese Medicine, Chengdu, 611137, China

A R T I C L E I N F O

Keywords: Scutellarin Colorectal cancer
Colitis-associated cancer Wnt
β-catenin

A B S T R A C T

Dysregulated Wnt/β-catenin signaling pathway plays a critical role in the pathogenesis of colorectal cancer (CRC). Scutellarin, a flavonoid compound in Scutellaria barbata, has been reported to suppress CRC, with the action mechanism elusive. In this study, Scutellarin was found to inhibit the carcinogenesis of colitis-associated cancer (CAC) in mice caused by azoXymethane/dextran sulfate sodium, with alleviation of pathologic symptoms.
Besides, Scutellarin attenuated mouse serum concentrations of TNF-α and IL-6, heightened Bax expression and
diminished B-cell lymphoma-2 (Bcl-2) level in CAC tissues of mice, through down-regulating Wnt/β-catenin signaling cascade. In CRC HT-29 cells, Scutellarin retarded the proliferation and migration, induced apoptosis, with boosted Bax expression and decreased Bcl-2 level, which may be attributed to its repression of Wnt/ β-catenin signals in HT-29 cells. Our findings demonstrate that Scutellarin may ameliorate colitis-associated colorectal cancer by weakening Wnt/β-catenin signaling cascade.

1. Introduction

Colorectal cancer (CRC) is one of the heterogeneous diseases with high morbidity and mortality (Wang et al., 2019), and it often occurs at the junction of the rectum and sigmoid colon, mostly driven by persis- tent colitis (Lu et al., 2019). Over the past decades, CRC including colitis-associated cancer (CAC) has posed a serious threat to people’s health and life. Distant metastasis of CRC is the main cause of the low cure rate and high death rate for patients with CRC (Sung et al., 2021). Therefore, the discovery of anti-CRC agents with high performance and less adverse reaction is constantly a research hotspot in the biomedical community.
A growing body of evidence reveals that Wnt/β-catenin signaling
pathway plays a critical role in the developmental biology and the pathogenesis of various types of cancer (Caspi et al., 2021; Wen et al., 2020). In particular, aberrant activation of Wnt/β-catenin signaling pathway is associated with the proliferation, migration and invasion of CRC (Chen et al., 2021; Jiao et al., 2020), gastric cancer (Xu et al., 2020), and hepatocellular carcinoma (Guo et al., 2020).

Scutellarin, a flavonoid compound, is an active ingredient in Scutel- laria barbata, a traditional Chinese herb broadly used in China for the medication of various malignancies including CRC (Zhao et al., 2021). Cumulative documents indicate that Scutellarin possesses a vast array of pharmacological activities, such as anti-cancer (Tan et al., 2020), anti-inflammation (Sung et al., 2015), anti-dementia (Zeng et al., 2018), anti-ischemic injury (Sun et al., 2018), anti-angiogenesis and heart protection (Long et al., 2019). As for cancer, Scutellarin was reported to inhibit the proliferation, migration and anchorage-independent growth of CRC HCT116 cells by suppressing hedgehog signaling pathway ac- tivity (Tan et al., 2020), and induce apoptosis of HCT116 cells by regulating p53 and Bcl-2/Bax expression (Yang et al., 2017). Also, Scutellarin inhibits the metastasis and angiogenesis of CRC via targeting ephrinb2 signaling (Zhu et al., 2017). In addition, Scutellarin is a novel sensitizing agent for both resveratrol- and 5-fluorouracil (5-Fu)-evoked apoptosis of HCT116 cells, by enhancing the activation of caspase-6 in a p53-dependent pattern (Chan et al., 2009).
Although there are some reports regarding the efficacy of Scutellarin on CRC (Chan et al., 2009; Tan et al., 2020; Yang et al., 2017; Zhu et al.,
* Corresponding author. Department of Pharmacology, Chengdu University of Traditional Chinese Medicine, 1166 Liutai Avenue, Wenjiang, Chengdu, 611137, China.
E-mail addresses: [email protected], [email protected] (H. Xu).
Received 3 March 2021; Received in revised form 7 June 2021; Accepted 7 June 2021
Available online 9 June 2021
0014-2999/© 2021 Published by Elsevier B.V.

2017), the in-depth mechanism by which Scutellarin protects against CRC remains elusive. Particularly, the influence of Scutellarin on the Wnt/β-catenin signaling cascade in CRC is quite obscure. Hereby, we strove to detect the effectiveness of Scutellarin on CAC, and decipher the action mechanism in the context of Wnt/β-catenin signaling pathway, so as to provide a novel insight into the medication of CRC with Scutellarin in the clinical setting.
2. Materials and methods

2.1. Chemicals and reagents

Scutellarin supplied by Must Biotechnology Co. (Chengdu, China) was dissolved in dimethyl sulfoXide (DMSO) and stored in the dark at 4 ◦C. 5-Fu, azoXymethane (AOM) and dextran sulfate sodium (DSS)
were purchased from Sigma-Aldrich (USA). The kits for 3-(4,5-dime- thylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay and apoptosis assay were acquired from Beyotime Biotechnology Co. (Shanghai, China), and ELISA (enzyme-linked immunosorbent assay) kits for mouse interleukin 6 (IL-6) and mouse tumor necrosis factor-
alpha (TNF-α) were obtained from MultiScience Lianke Biotech Co.
(China). AXygen® AXyPrep Multisource RNA Miniprep Kit was bought from Corning (USA). PrimeScript RT reagent Kit and SYBR® PremiX DimerEraser™ (Perfect Real Time) were gotten from Takara Biomedical Technology (Beijing). Cytoplasmic & nuclear extraction kit was supplied by Invent Biotechnologies Inc. (USA). Primary antibodies against glyceraldehyde-3-phosphate dehydrogenase (GAPDH), lamin B1, β-cat- enin, GSK-3β (glycogen synthase kinase-3β), T-cell factor 4 (TCF4), cyclin D1, c-Myc, Bax, Bcl-2 were purchased from Proteintech Group (China), primary antibody to phospho-GSK-3β (Ser 9) was obtained from Cell Signaling Technology Inc. (USA). All other reagents were readily available commercially.
2.2. Animals and treatment regimens

The mouse model of CAC was set up with AOM/DSS as previously described (Thaker et al., 2012). The animal experimental procedures were approved by the Animal EXperimentation Ethics Committee of Chengdu University of Traditional Chinese Medicine (Application Approval No. 2019–22). Eight-week-old male C57BL/6 mice were housed, with standard chow and double distilled water (ddH2O) ad libitum, in a ventilated and humidity-controlled animal facility. After 1 week of acclimation, mice were randomly arranged into 6 groups, including normal control, model group, 25 mg/kg Scutellarin, 50 mg/kg Scutellarin, 100 mg/kg Scutellarin, 20 mg/kg 5-Fu group. EXcept for the normal control, other 5 groups of mice were subjected to intraperitoneal injection of AOM at 12 mg/kg once. One week later, the 5 groups of mice were given 2% DSS in drinking water for one week, followed by two weeks of standard drinking water, which were repeated for 2 cycles. During the 3 cycles of treatment, the 5 groups of mice were intraperi- toneally injected with DMSO-saline (vehicle for Scutellarin), Scutellarin in doses of 25 mg/kg, 50 mg/kg and 100 mg/kg, or 20 mg/kg of 5-Fu respectively at 10 ml/kg once per day, with the normal control group of mice receiving saline at 10 ml/kg. Simultaneously, the body weight and disease activity index (DAI) of the mice were recorded. Eventually, the mice were euthanized, and the colorectal length and related in- dicators were measured, followed by specimen retrieval for downstream assays.
2.3. Assessment of mice’s feces

The stool nature, including the shape, blood and diarrhea, were monitored for mice every other day (Wei et al., 2016), and the average value for one week was recorded. No blood in the stool was counted as 0 point, minor bleeding as 1 point, and heavy bleeding as 2 points. The intact granular stool was scored as 0 point, soft particles as 1 point,

mushy stool as 2 points, and gross stool as 3 points.
2.4. Determination of the concentrations of TNF-α and IL-6 in mice’s sera
After the harvest of mice’s blood, the sera were separated. Then, with ELISA kits, the serum concentrations of TNF-α and IL-6 were determined by the absorbance at a wavelength of 450 nm, as per the manufacturer’s protocol.

2.5. Hematoxylin and eosin (H&E) staining of CAC tissues of mice

The paraffin-embedded CAC tissues of mice were cut into the sec- tions of 5 μm thickness, treated with Xylene and ethanol, stained with hematoXylin and eosin, and the CAC tissues were observed under a light microscope.
2.6. Immunohistochemical (IHC) analysis

After the deparaffinization with Xylene and ethanol and the rehy- dration with tap water, the sections were incubated with 1% sodium citrate for antigen retrieval and treated with 3% H2O2 for 30 min to block endogenous catalase. Subsequently, the sections were treated with 3% bovine serum albumin (BSA) solution, followed by incubation with
primary antibodies against β-catenin (1:200), GSK-3β (1:200), c-Myc (1:100), Bax (1:200), Bcl-2 (1:100) at 4 ◦C overnight. After being washed
with phosphate buffer saline (PBS) thrice, the sections were incubated with HRP (horseradish peroXidase)-conjugated secondary antibody for 1 h at room temperature (RT), developed with 3,3′-diaminobenzidine
(DAB) chromogenic solution, treated with hematoXylin to counterstain the nuclei, and coverslipped with mounting medium, followed by visualization under a light microscope. For immunofluorescence stain- ing of β-catenin, the sections were stained with FITC-conjugated sec- ondary antibody at RT for 50 min, followed by visualization under a fluorescence microscope.
2.7. Cell culture and treatment

Human colorectal adenocarcinoma cells HT-29, originally derived from American Type Culture Collection (ATCC), were maintained by McCoy’s 5A medium supplemented with 10% of heat-inactivated fetal bovine serum (FBS), 100 U/ml of penicillin and 100 μg/ml of strepto-
mycin, in an incubator with 5% CO2 at 37 ◦C. After treatment with
various concentrations of Scutellarin and 5-Fu for diverse periods, the cells were subject to downstream assays.
2.8. MTT assay of cell proliferation

MTT assay of cell proliferation was conducted, as previously described (Wan et al., 2018). Briefly, HT-29 cells were seeded in a
96-well plate at a density of 5 × 103 cells per well, followed by treatment
with Scutellarin at 60 μM, 120 μM, 180 μM, 240 μM, 300 μM, 360 μM
and 400 μM, or 5-Fu at 20 μM for 48 h. Next, 100 μl of culture medium containing 10% MTT was applied to cells for 4-h incubation, followed by addition of 150 μl MTT solvent, incubation in the dark for 15 min, and measurement of the absorbance at a wavelength of 570 nm.
2.9. Wound healing assay of cell migration

The wound healing assay was employed to appraise cell migration, as described elsewhere (Rodriguez et al., 2005), with minor modification. Briefly, HT-29 cells were seeded in 24-well plates and grown to 80% confluence. A straight would line was scratched on the cell monolayer with a p10 pipette tip, followed by gentle wash with PBS thrice to
remove the detached cells. HT-29 cells were fed with cell culture me- dium containing various concentrations of Scutellarin, 20 μM of 5-Fu, or 1‰ DMSO as the vehicle control, for an additional 48 h, with being

concomitantly photographed at 0 h, 24 h, 48 h for analysis of cell migration under a microscope, followed by measurement of the width of the scratched area with the Image J software. The 24 h cell migration
index =(W0–W24)/W0 × 100%, and 48 h cell migration index
(W0–W48)/W0 100%. The W0, W24 and W48 represent the width
of the scratched area at 0 h, 24 h and 48 h respectively.

2.10. Hochest 33258 staining
HT-29 cells were seeded in a 96-well plate at a density of 5 103 cells per well, followed by treatment with Scutellarin at diversified concentrations, 5-Fu at 20 μM, or 1‰ DMSO as the vehicle control, for
48 h. Then, HT-29 cells were incubated with 4 μg/μL Hochest 33258 for
15 min, followed by three washes with PBS and observation under a fluorescence microscope.
2.11. Immunocytochemical (ICC) analysis

HT-29 cells were seeded in a 12-well plate containing a cover glass and grown to 80% confluence, followed by treatment with Scutellarin or 5-Fu for 48 h. After fiXation with 4% paraformaldehyde at ambient temperature for 15 min, HT-29 cells were washed with PBS thrice and incubated with 1% Triton X-100 in PBS for 10 min, followed by blockage
with 3% BSA for 1 h. Next, HT-29 cells were incubated with primary antibody against β-catenin (1:200) at 4 ◦C overnight, followed by being stained with FITC-conjugated secondary antibody at ambient tempera-
ture for 50 min. After gentle washes with PBS, the cover slip-contained cells were mounted onto a slide with a drop of anti-fluorescence quenching agent, followed by visualization under a fluorescence microscope.
2.12. Western blot analysis

Western blot analysis was performed as previously described else- where, with minor modification (Tan et al., 2020). The tissues and cells were harvested and homogenized on ice with RIPA (radio-
immunoprecipitation assay) buffer (150 mM sodium chloride, 1.0%

isolation with a multisource RNA miniprep kit (AXygen). After quanti- tation with NanoDrop 2000 micronucleic acid analyzer, the total RNA was reversely transcribed to cDNA by PrimeScript™ RT reagent Kit, followed by real-time quantitative polymerase chain reaction with SYBR® PremiX DimerEraser™ kit (Takara) on Bio-Rad iCycler iQ real- time PCR detection system in a 96-well plate format, in light of the manufacturer’s protocol. β-Actin was used as an endogenous reference gene to generate normalized relative expression values for the genes of interest. Primer sequences for specific genes were shown in Table 1. Fold differences relative to the control were analyzed with the comparative Ct method (△△Ct algorithm).

2.14. Data analysis

The data were analyzed by one-way analysis of variance (ANOVA) with SPSS19.0 software, expressed as mean S.D. (standard deviation). A two-sided value of P < 0.05 was considered statistically significant,
and P < 0.01 was considered to be extremely statistically significant.
3. Results
3.1. Scutellarin ameliorates AOM/DSS-induced CAC in mice

To explore the effect of Scutellarin on CAC, we first established the model of CAC in mice, using AOM/DSS, with various treatment regi- mens ( 1A). Then, we found that intraperitoneal injection of Scu- tellarin and 5-Fu alleviated the tumor load of CAC in mice, reversed the shortening of colorectum caused by AOM/DSS ( 1B), and increased the survival rate of CAC mice (1C). Meanwhile, the symptoms of CAC in mice, including poor activity, low energy, blunt response and dull fur, were reduced by Scutellarin and 5-Fu, supported by more body weight gain ( 1D), decreased bleeding score of mice’s stool ( 1E),
lower diarrhea score of mice’s feces ( 1F), and less pathogenic
alteration for CAC in mice ( 1G).

Table 1

NP-40 or Triton X-100, 0.5% sodium deoXycholate, 0.1% sodium dodecyl sulfate, 50 mM Tris, pH 8.0) containing protease inhibitors and phosphatase inhibitors, by dounce homogenization (a dounce homoge- nizer) for tissues or hydrodynamic shearing (a 21-gauge needle) for
cells, followed by centrifugation at 10,000 g at 4 ◦C for 10 min,
generating the total cell lysate in the supernatant fluid. For fractionation of nuclear protein, the Minute™ cytoplasmic and nuclear extraction kit (Invent Biotechnologies Inc, USA, catalog number: SC-003) was utilized, according to the manufacturer’s instructions. Then, the whole cell lysate and nuclear fraction were quantitated with BCA (bicinchoninic acid) protein assay as per the user manual. Next, 20 μg of protein per lane were fractionated with sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE), and transferred to polyvinylidene difluoride (PVDF) membrane. After blockage with 3% BSA in TBST (Tris-Buffered Saline and Tween 20) for 45min at RT, the PVDF membrane was probed with primary antibodies to GAPDH (1:5000), lamin B1 (1:2000), β-catenin (1:5000), GSK-3β (1:2000), p-GSK-3β (1:1000), TCF4 (1:1000), cyclin
D1 (1:2000), c-Myc (1:1000), Bax (1:2000), Bcl-2 (1:2000) at 4 ◦C
overnight. After three washes with TBST, the PVDF membrane was incubated with HRP-conjugated secondary antibody at a dilution of
1:2000 at RT for 90 min. The immunoreactivities were detected with enhanced chemiluminescence (ECL) kit, imaged on ChemiDoc XRS+
system (Bio-Rad, California, USA) and analyzed with Bio-Rad Quantity One 1-D analysis software.
2.13. Real-time qRT-PCR (real-time quantitative reverse transcription- polymerase chain reaction) analysis
The tissues and cells were harvested and processed for total RNA

Primer sequences of the genes for Real-Time qRT-PCR.
Gene name Primer sequence

Mouse β-actin (Forward) 5＇- CATGAAGTGTGACGTGGACATC -3＇ Mouse β-actin (Reverse) 5＇- CAGGAGGAGCAATGATCTTGATC -3＇ Mouse Bax (Forward) 5＇- GAACAGATCATGAAGACAGCG -3＇

Mouse Bax (Reverse) 5＇- CAGTTCATCTCCAATTCGCC -3＇ Mouse Bcl-2 (Forward) 5＇- GGGAGAACAGGGTACGATAA -3＇ Mouse Bcl-2(Reverse) 5＇- CCCACCGAACTCAAAGAA-3＇ Mouse β-catenin (Forward) 5＇- TAGGCACCAGGGTGTGATG -3＇ Mouse β-catenin Reverse 5＇- GTGGTGCCAGATCTTCTCCA -3＇ Mouse GSK3β (Forward) 5＇- GCCGAGGCAGTTGTAAACGA -3＇ Mouse GSK3β (Reverse) 5＇- CTGAGCCCTGCTTCTGTGAG -3＇ Mouse TCF4 (Forward) 5＇- ATATCCCACAGTCCAGCAGC -3＇ Mouse TCF4 (Reverse) 5＇- ATGGAACGTGGACATCGGAG -3
Mouse c-Myc (Forward) 5＇- GCAGCGACTCTGAAGAAGAG -3＇ Mouse c-Myc (Reverse) 5＇- GTAGTTGTGCTGGTGAGTGG -3＇ Mouse cyclinD1 (Forward) 5＇- CATTCCCTTGACTGCCGAGA -3＇ Mouse cyclinD1 (Reverse) 5＇- TCCACTTGAGCTTGTTCACCA -3＇ Human β-actin (Forward) 5＇- CATGAAGTGTGACGTGGACATC -3＇ Human β-actin (Reverse) 5＇- CAGGAGGAGCAATGATCTTGATC -3＇ Human Bax (Forward) 5＇- ATGATTGCCGCCGTGGACACAG -3＇
Human Bax (Reverse) 5＇- ACAGGGCCTTGAGCACCAGTTTG -3＇ Human Bcl-2 (Forward) 5＇- TGGGGTCATGTGTGTGGAGA -3＇ Human Bcl-2(Reverse) 5＇- TAACACAAGGGCATCCCAGC -3＇ Human β-catenin (Forward) 5＇- GCAACTAAACAGGAAGGGATGGA -3＇ Human β-catenin Reverse 5＇- TCTATACCACCCACTTGGCAGA -3＇ Human GSK3β (Forward) 5＇- CAAGAAGTCAGCTATACAGACAC -3＇ Human GSK3β (Reverse) 5＇- GGAGCTCTCGATTCTTAAATCTC -3＇ Human TCF4 (Forward) 5＇- ACTGTCCAGAGAAGAGCAAGCGA -3＇ Human TCF4 (Reverse) 5＇- TTTCCATAGTTATCCCGCGCGGA -3＇
Human c-Myc (Forward) 5＇- GCGACTCTGAGGAGGAACAAGAAG -3＇ Human c-Myc (Reverse) 5＇- CGTAGTTGTGCTGATGTGTGGAGA -3＇ Human cyclinD1 (Forward) 5＇- GCCACAGATGTGAAGTTCATTTCC -3＇ Human cyclinD1 (Reverse) 5＇- GTCACACTTGATCACTCTGGAGA -3＇

 1. Scutellarin ameliorates AOM/DSS-induced CAC in mice. (A) The modeling method of AOM/DSS-induced CAC in mice and treatment regimens. (B) Repre- sentative photographs of AOM/DSS-induced CAC in mice, and colorectal length of mice. (C) The survival rate of mice. (D) The body weight of mice. (E) The bleeding score of mice’s feces. (F) The diarrhea score of mice’s feces. (G) Representative images of H&E-stained colorectal tissues of mice. The scale bar is 200 μm. (H) The

concentrations of TNF-α and IL-6 in mice’s sera were determined with ELISA kits, as per the manufacturer’s protocol. N = 6, *P < 0.05, **P < 0.01 versus the
model group.
To further probe the influence of Scutellarin on the inflammatory reaction in CAC mice, the levels of pro-inflammatory factors including TNF-α and IL-6 were measured in mice’s sera. It was found that Scu- tellarin and 5-Fu significantly attenuated the serum concentrations of TNF-α and IL-6, in comparison with the model group ( 1H), hinting that Scutellarin potentially suppresses the inflammatory situation, which may be one of the mechanisms underlying the efficacy of Scu- tellarin on CAC.

3.2. Scutellarin alters the expression of Bax and Bcl-2 in CAC tissues of mice
Given that Scutellarin suppressed the carcinogenesis of AOM/DSS-induced CAC in mice, we speculated if Scutellarin causes apoptotic death in CAC, which is a common type of cellular process induced by miscellaneous anti-cancer agents. Intriguingly, IHC analysis revealed that Scutellarin at various doses and 5-Fu all heightened Bax protein expression and diminished Bcl-2 protein expression in CAC tissues of mice ( 2A), which was consistent with the result of western blotting, where Bax protein level was elevated and Bcl-2 protein level was miti- gated by Scutellarin in a dose-dependent manner ( 2B). Further, these data were validated by Real-Time qRT-PCR analysis, which indi- cated that Bax mRNA expression was enhanced and Bcl-2 mRNA expression was lessened by Scutellarin and 5-Fu in CAC tissues of mice ( 2C). Since Bax is a pro-apoptotic gene, and Bcl-2 serves as an apoptosis suppressor gene, it was deduced that Scutellarin potentially

2. Scutellarin alters the expression of Bax and Bcl-2 in CAC tissues of mice. (A) IHC analysis of the protein expression of Bax and Bcl-2 in CAC tissues of mice. The scale bar is 50 μm. (B) Western blot analysis of the protein expression of Bax and Bcl-2 in CAC tissues of mice. N = 3, *P < 0.05, **P < 0.01 versus the model group.
(C) Real-Time qRT-PCR analysis of the mRNA expression of Bax and Bcl-2 in CAC tissues of mice. N = 4, *P < 0.05, **P < 0.01 versus the model group.

induces the apoptosis of CAC, contributing to the inhibitory action of Scutellarin on CAC.
3.3. Scutellarin down-regulates Wnt/β-catenin signaling pathway activity in CAC tissues of mice
It is well established that multiple signaling cascades are involved in the oncogenesis of CRC, such as Wnt. Notch, Hedgehog, Hippo, etc (Chen et al., 2021). And, numerous lines of evidence indicate that Wnt/β-catenin plays a crucial role in the pathogenesis of CRC. To discover the mechanism responsible for Scutellarin ameliorating CAC, the impact of Scutellarin on Wnt/β-catenin signaling pathway activity was investigated. As β-catenin is a pivotal transcription factor in the Wnt signaling cascade, and translocation of β-catenin from the cytoplasm to the nucleus is a prerequisite for activation of target gene transcription, the effect of Scutellarin on β-catenin level was first examined. It was unveiled that β-catenin protein expression in CAC tissues of mice was sharply down-regulated by Scutellarin, evidenced by the results of IHC analysis ( 3A) and immunofluorescent analysis ( 3B). Further, western blotting analysis demonstrated that Scutellarin lowered not only the level of total cellular β-catenin protein but also the level of nuclear β-catenin protein ( 3C), suggesting Scutellarin inhibits nu- clear translocation of β-catenin in CAC tissues of mice.
GSK-3β, an important kinase in Wnt/β-catenin signaling pathway,
can phosphorylate the β-catenin, eliciting the degradation of β-catenin by ubiquitin-proteasome system (UPS). Besides, GSK-3β may be phos- phorylated by PKC, resulting in the abrogation of the action of GSK-3β on phosphorylating β-catenin. In our study, Scutellarin increased the protein level of GSK-3β in CAC tissues of mice, as indicated by IHC analysis (3A) and Western blot analysis ( 3D). Also, Scutellarin substantially mitigated the level of phospho-GSK-3β protein ( 3D), implying that Scutellarin may protect the action of GSK-3β on phos- phorylating β-catenin, by inhibiting the inactivation of GSK-3β protein. TCF4, another transcription factor, is reported to form a complex with β-catenin to co-activate the expression of downstream genes in Wnt signaling pathway. In the context of CAC tissues of mice, Scutellarin encumbered TCF4 protein expression in a dose-dependent pattern (3F). Also, IHC and western blotting showed that Scutellarin impeded the protein expression of target genes of Wnt signaling cascade,
including c-Myc ( 3A and E), and cyclin D1 (3E).
In addition, the effects of Scutellarin on the levels of the above proteins were underpinned by the data of qRT-PCR analysis, which demonstrated that Scutellarin dose-dependently lessened the mRNA expression of β-catenin, TCF4, c-Myc and cyclin D1, and enhanced that of GSK-3β in CAC tissues of mice ( 3G and H).
3.4. Scutellarin inhibits the malignant phenotype of human colorectal adenocarcinoma HT-29 cells
To deeply discover the efficacy of Scutellarin on CRC, the effect of Scutellarin on the malignant phenotype of CRC cells in vitro and its underlying mechanism were next explored. It was found that Scu- tellarin, at concentrations ranging from 60 μM to 400 μM, hindered the proliferation of human colorectal adenocarcinoma HT-29 cells in a concentration-dependent fashion ( 4A and D). Further, Scutellarin at 90 μM, 180 μM and 360 μM, and 5-Fu at 20 μM all drastically retarded the migration of HT-29 cells at 24h and 48h in vitro ( 4B and C). Representative images of the migration and the proliferation of HT-29 cells treated with Scutellarin or 5-Fu were shown in 4C and D.
3.5. Scutellarin induces apoptosis of HT-29 cells Apoptosis is a multifaceted process implicating several morpholog- ical changes, like plasma membrane blebbing, cell shrinkage, and nu- clear condensation. Subsequently, the potency of Scutellarin on the apoptosis of HT-29 cells was evaluated with Hochest 33258 staining analysis, which revealed that Scutellarin-treated cells exhibited shrinkage of nuclei with bright blue color, indicative of the induction of apoptosis in HT-29 cells by Scutellarin ( 5A). This kind of property of Scutellarin is partly attributable to its influence on the expression of Bax and Bcl-2, because Scutellarin strikingly raised Bax protein expression and weakened Bcl-2 protein level in HT-29 cells ( 5B), which coin- cided with the results of qRT-PCR analysis, certifying that Scutellarin noticeably strengthened Bax mRNA expression and depleted Bcl-2 mRNA level in HT-29 cells (5C).

3.6. Scutellarin suppresses Wnt/β-catenin signaling pathway activity in HT-29 cells
Subsequently, the role of Scutellarin in Wnt/β-catenin signaling pathway in HT-29 cells was clarified. The level of β-catenin protein in HT-29 cells was notably attenuated by Scutellarin at.
90 μM, 180 μM and 360 μM, and 5-Fu at 20 μM, supported by immunofluorescent analysis ( 6A) and western blotting (6D). Also, Scutellarin encumbered the nuclear translocation of β-catenin in HT-29 cells, evidenced by that Scutellarin diminished the nuclear level of β-catenin protein (6D).
GSK-3β, an inhibitor of β-catenin, was found to be overexpressed in
HT-29 cells by Scutellarin ( 6C), with phospho-GSK-3β level decreased by Scutellarin  suggesting that Scutellarin may curb the inactivation of GSK-3β protein by restraining GSK-3β phosphoryla- tion in HT-29 cells, which may potentially result in β-catenin phos- phorylation and degradation.
The protein expression of TCF4, a co-activator for β-catenin on gene transcription, was revealed to be hindered in HT-29 cells by Scutellarin ( 6B), that at 90 μM, 180 μM and 360 μM also weakened the protein expression of downstream genes of Wnt/β-catenin signaling pathway, such as c-Myc and cyclin D1 ( 6B).
Eventually, these actions of Scutellarin on the expression of Wnt/ β-catenin-related genes were verified by qRT-PCR analysis, which demonstrated that Scutellarin boosted GSK-3β mRNA expression, while reduced the mRNA levels of β-catenin, TCF4, c-Myc and cyclin D1 in HT- 29 cells in a concentration-dependent mode ( 6E).
4. Discussion

CRC is a major public health problem, as CRC is the third most commonly diagnosed cancer type and is the second leading cause of cancer death worldwide. With the development of society, unhealthy dietary habits and lifestyles strongly exacerbate the incidence of CRC.
At present, medical management of CRC is mainly based on chemotherapy, radiotherapy and surgical resection, but the high rates of recurrence and metastasis lead to poor prognosis for CRC patients. Therefore, attention of the world has been drawn to complementary and alternative therapy, for instance, traditional Chinese medicine, which is of importance to therapeutic intervention in various afflictions including CRC (Sun et al., 2020; Wan et al., 2018; Zhao et al., 2021). Being a bioactive constituent of Scutellaria barbata with anti-tumor property, Scutellarin manifests potent efficacy against a variety of cancers, including especially CRC (Chan et al., 2009; Tan et al., 2020; Xiong et al., 2020; Yang et al., 2017; Zhu et al., 2017), with unclear action mechanism which merits extensive and intensive exploration.
It has become a widely held view that deregulated Wnt/β-catenin
signaling pathway is implicated in the initiation and progression of various cancers, including CRC. Being the core component of Wnt/ β-catenin signaling pathway, β-catenin plays a paramount role in Wnt signal transduction (Tewari et al., 2021), by translocating into the nu- cleus to coactivate, with TCF4, the transcription of downstream genes, including c-Myc and cyclin D1, giving rise to the pathogenic phenotype of CRC, such as proliferation, metastasis, chemoresistance and recur- rence, etc (Bian et al., 2020). Hence, therapeutically targeting β-catenin may serve as a promising approach to intervene in cancer for clinical

3. Scutellarin down-regulates Wnt/β-catenin signaling pathway activity in CAC tissues of mice. (A) IHC analysis of the protein expression of β-catenin, GSK-3β and c-Myc in CAC tissues of mice. The scale bar is 50 μm. (B) Immunofluorescent analysis of β-catenin in CAC tissues of mice. The scale bar is 200 μm. (C, D, E, F) Western blot analysis of the protein expression of β-catenin, nuclear β-catenin, GSK-3β, phospho-GSK-3β, c-Myc, cyclin D1 and TCF4 in CAC tissues of mice. N = 3, *P
< 0.05, **P < 0.01 versus the model group. (G, H) Real-Time qRT-PCR analysis of the mRNA expression of β-catenin, GSK-3β, TCF4, c-Myc and cyclin D1 in CAC
tissues of mice. N = 4, *P < 0.05, **P < 0.01 versus the model group.

4. Scutellarin inhibits the malignant phenotype of human colorectal adenocarcinoma HT-29 cells. (A) MTT assay of cell proliferation of HT-29 cells. N = 5, *P < 0.05, **P < 0.01 versus the control group. (B) Wound healing assay of cell migration of HT-29 cells. N = 3, *P < 0.05, **P < 0.01 versus the control group. (C) Representative images of cell migration of HT-29 cells. (D) Representative images of cell proliferation of HT-29 cells practice.

It was documented that HMQ-T-F5, a derivative of Taspine, inhibits the proliferation and migration, and induces apoptosis of cervical cancer HeLa cells, by attenuating the expression and nuclear translocation of β-catenin, and hindering GSK-3β phosphorylation, indicative of down- regulation of the activity of Wnt/β-catenin signaling pathway by

HMQ-T-F5 (Dai et al., 2018). Besides, Scutellarin was reported to ameliorate cartilage degeneration in osteoarthritis via suppressing Wnt/β-catenin signaling cascade, evidenced by that scutellarin retards the translocation of β-catenin into the nucleus (Liu et al., 2020). In this study, we demonstrated that Scutellarin protected against experimental CRC in vivo and in vitro, by significantly lessening the expression of

5. Scutellarin induces apoptosis of HT-29 cells. (A) Hochest 33258 staining analysis of Scutellarin-induced apoptosis of HT-29 cells. (B) Western blot analysis of the protein expression of Bax and Bcl-2 in HT-29 cells. N = 3, *P < 0.05, **P < 0.01 versus the control group. (C) Real-Time qRT-PCR analysis of the mRNA expression of Bax and Bcl-2 in HT-29 cells. N = 4, *P < 0.05, **P < 0.01 versus the control group.
β-catenin mRNA and protein, and impeding the nuclear translocation of β-catenin in CAC tissues of mice and CRC HT-29 cells, in accordance with the above literature.
GSK-3β, a type of serine/threonine protein kinase, is found to exist in all eukaryotic cells (Zhou et al., 2016), and participate in multiple bio- logical processes, including particularly glycogen metabolism. Emerging evidence reveals that GSK-3β may phosphorylate cytoplasmic β-catenin, leading to degradation of β-catenin by AXin/GSK-3β/APC complex via ubiquitination in the cytoplasm (Salim et al., 2013). On GSK-3β, phos- phorylation at serine-9 by PKC may take place, which abrogates GSK-3β′ s function of phosphorylating β-catenin. Consequently, β-catenin is not degraded by AXin/GSK-3β/APC complex, resulting in the accu- mulation of β-catenin in the cytoplasm, followed by the entry of β-cat- enin into the nucleus to activate downstream gene transcription (Cohen and Frame, 2001; Wang et al., 2014).
It was reported that prodigiosin ameliorates breast cancer by blocking Wnt/β-catenin signaling cascade, evidenced by down- regulation of Ser 9-phosphorylated GSK-3β level, LRP6 phosphoryla- tion and cyclin D1 expression by prodigiosin (Wang et al., 2016). Similarly, we found that Scutellarin suppressed CRC by mitigating the phosphorylation of GSK-3β at serine-9 in CAC tissues of mice and HT-29 cells, which confers GSK-3β the activity of phosphorylating β-catenin. Given that HT-29 cells harbor truncated protein of APC (adenomatous polyposis coli), a tumor suppressor gene (Kapitanovic et al., 2006), the constitutive level of β-catenin is relatively higher in HT-29 cells than that in other CRC cell lines. Consequently, it was not easy for Scutellarin to influence the phosphorylation of β-catenin in HT-29 cells, due to dysfunction of the AXin/GSK-3β/APC complex, even if Scutellarin pro- tected the phosphorylating activity of GSK-3β. Therefore, the decreased protein level of GSK-3β in HT-29 cells may be mainly attributed to

inhibition on mRNA transcription by Scutellarin.
The c-Myc is one of downstream target genes of Wnt/β-catenin signaling pathway, and it is a proto-oncogene encoding a nuclear phosphoprotein, that promotes the proliferation and metastasis of tumor cells. On the other hand, c-Myc facilitates the escape of anti-tumor im- mune response (de Jonge et al., 2020). We found that Scutellarin less- ened c-Myc expression in CAC tissues of mice and HT-29 cells, which was in agreement with numerous reports that suppressing c-Myc con- tributes to the anti-cancer outcome in the clinical setting (Elbadawy et al., 2019). The cyclin D1 is another target gene of Wnt/β-catenin signaling cascade, and it is characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Overexpression of cyclin D1, which alters cell cycle progression, is observed frequently in a va- riety of human cancers, including CRC. In CAC tissues of mice and HT-29 cells, cyclin D1 level was lowered by Scutellarin in a dose or concentration-dependent fashion, coinciding with other reports that Scutellarin inhibits the proliferation of lung adenocarcinoma A549 cells and renal carcinoma cells by reducing cyclin D1 expression (Cao et al., 2019; Deng et al., 2018).
Apoptosis is a process of programmed cell death, featured with cell shrinkage, blebbing, chromatin condensation, chromosomal DNA frag- mentation, and apoptotic bodies. It is well known that insufficient apoptosis results in uncontrolled cell proliferation, such as cancer. Then, induction of cell apoptosis is a promising strategy of effective therapy for diverse malignancies (Godwin et al., 2021; Gullulu et al., 2021; Patra et al., 2021; Rajabi et al., 2021). Amid the process of cell apoptosis, Bcl-2 gene family, especially Bcl-2 and Bax, may play a crucial role, which renders Bcl-2 and Bax therapeutic targets for varieties of cancers. Scu- tellarin was reported to induce the apoptosis of CRC HCT116 cells (Yang et al., 2017), leukemia K562 cells (Bao et al., 2020), ovarian cancer cells

6. Scutellarin suppresses Wnt/β-catenin signaling pathway activity in HT-29 cells. (A) Immunofluorescent analysis of nuclear translocation of β-catenin in HT- 29 cells. The scale bar is 50 μm. (B, C, D) Western blot analysis of the protein expression of TCF4, c-Myc, cyclin D1, GSK-3β, phospho-GSK-3β, β-catenin and nuclear β-catenin in HT-29 cells. N = 3, *P < 0.05, **P < 0.01 versus the control group. (E) Real-Time qRT-PCR analysis of the mRNA expression of β-catenin, GSK-3β, TCF4, c-Myc and cyclin D1 in HT-29 cells. N = 4, *P < 0.05, **P < 0.01 versus the control group.

(Xie et al., 2019), by decreasing Bcl-2 expression and increasing Bax level. Consistently, in CAC tissues of mice and HT-29 cells, Bcl-2 expression was reduced and Bax level was heightened by Scutellarin, which also elicited apoptotic morphology in HT-29 cells. These results in our study may suggest that Scutellarin potentially induces cell apoptosis in CAC. However, more experiments need to be performed to validate the effect of Scutellarin on CRC cell apoptosis, such as FCM analysis of apoptosis rate and cell cycle arrest.
In addition, accumulating evidence reveals that colitis is a major risk factor of CRC (Bocchetti et al., 2021; Fantini and Guadagni, 2021). The colitis, particularly ulcerative colitis, is a type of precancerous lesion of the colorectum. One of the most serious and life-threatening conse- quences of colitis is the development of CRC (Ibrahim et al., 2019; Yashiro, 2014). In our study, CAC model was established with AOM/DSS
in mice (Thaker et al., 2012), and Scutellarin attenuated the serum concentrations of TNF-α and IL-6 in CAC mice, suggesting the Scutellarin may alleviate the inflammatory state to facilitate its therapeutic effects on CRC.
5. Conclusion

Collectively, our findings demonstrate that Scutellarin ameliorates

CAC by suppressing Wnt/β-catenin signaling cascade, contributing to the mechanistic understanding of the efficacy of Scutellarin on CRC in the clinical setting.
CRediT authorship contribution statement
Sha Zeng: drafted the manuscript, carried out the study, conceived and designed the research project. Li Chen: carried out the study. Qiang Sun: carried out the study. Hui Zhao: carried out the study. Han Yang: carried out the study. Shan Ren: carried out the study. Maolun Liu: carried out the study. Xianli Meng: conceived and designed the research project. Haibo Xu: revised the manuscript, conceived and designed the research project, All authors have read and approved the final manuscript for publication.

Declaration of competing interest

The authors declare no conflicts of interest.

Acknowledgments

This work was sponsored by the National Natural Science

Foundation of China (Nos. 81573813 and 81173598), Sichuan Provin- cial Administration of Traditional Chinese Medicine of China (No. 2021MS447), the EXcellent Talent Program of Chengdu University of Traditional Chinese Medicine of China (Nos. YXRC2019002 and ZRYY 1917), and the Open Research Fund of the State Key Laboratory of Southwestern Chinese Medicine Resources of China (No. 2020XSGG006).
Appendix A. Supplementary data

Supplementary data to this article can be found online
References
Bao, J., Xia, L., Zhao, Y., Xia, R., 2020. Scutellarin exerts anticancer effects on human leukemia cells via induction of Sub-G1 cell cycle arrest, apoptosis and also inhibits migration and invasion by targeting Raf/MEK/ERK signalling pathway. J BUON 25,
1050–1055.
Bian, J., Dannappel, M., Wan, C., Firestein, R., 2020. Transcriptional regulation of Wnt/ beta-catenin pathway in colorectal cancer. Cells 9, 2125.
Bocchetti, M., Ferraro, M.G., Ricciardiello, F., Ottaiano, A., Luce, A., Cossu, A.M., Scrima, M., Leung, W.Y., Abate, M., Stiuso, P., Caraglia, M., Zappavigna, S., Yau, T. O., 2021. The role of microRNAs in development of colitis-associated colorectal cancer. Int. J. Mol. Sci. 22, 3967.
Cao, P., Liu, B., Du, F., Li, D., Wang, Y., Yan, X., Li, X., Li, Y., 2019. Scutellarin suppresses proliferation and promotes apoptosis in A549 lung adenocarcinoma cells via AKT/
mTOR/4EBP1 and STAT3 pathways. Thorac Cancer 10, 492–500.
Caspi, M., Wittenstein, A., Kazelnik, M., Shor-Nareznoy, Y., Rosin-Arbesfeld, R., 2021.
Therapeutic targeting of the oncogenic Wnt signaling pathway for treating colorectal cancer and other colonic disorders. Adv. Drug Deliv. Rev. 169, 118–136.
Chan, J.Y., Tan, B.K., Lee, S.C., 2009. Scutellarin sensitizes drug-evoked colon cancer cell apoptosis through enhanced caspase-6 activation. Anticancer Res. 29, 3043–3047.
Chen, L., He, M., Zhang, M., Sun, Q., Zeng, S., Zhao, H., Yang, H., Liu, M., Ren, S., Meng, X., Xu, H., 2021. The Role of non-coding RNAs in colorectal cancer, with a focus on its autophagy. Pharmacol. Ther. 226, 107868.
Cohen, P., Frame, S., 2001. The renaissance of GSK3. Nat. Rev. Mol. Cell Biol. 2, 769–776.
Dai, B., Yang, T., Shi, X., Ma, N., Kang, Y., Zhang, J., Zhang, Y., 2018. HMQ-T-F5 (1-(4-
(2-aminoquinazolin-7-yl)phenyl)-3-(2bromo5- (trifluoromethoXy)phenyl) thiourea) suppress proliferation and migration of human cervical HeLa cells via inhibiting
Wnt/beta-catenin signaling pathway. Phytomedicine 51, 48–57.
de Jonge, A.V., Mutis, T., Roemer, M.G.M., Scheijen, B., Chamuleau, M.E.D., 2020.
Impact of MYC on anti-tumor immune responses in aggressive B cell non-hodgkin lymphomas: consequences for cancer immunotherapy. Cancers 12, 3052.
Deng, W., Han, W., Fan, T., Wang, X., Cheng, Z., Wan, B., Chen, J., 2018. Scutellarin
inhibits human renal cancer cell proliferation and migration via upregulation of PTEN. Biomed. Pharmacother. 107, 1505–1513.
Elbadawy, M., Usui, T., Yamawaki, H., Sasaki, K., 2019. Emerging roles of C-myc in cancer stem cell-related signaling and resistance to cancer chemotherapy: a potential therapeutic target against colorectal cancer. Int. J. Mol. Sci. 20, 2340.
Fantini, M.C., Guadagni, I., 2021. From inflammation to colitis-associated colorectal cancer in inflammatory bowel disease: pathogenesis and impact of current therapies.
Dig. Liver Dis. 53, 558–565.
Godwin, I., Anto, N.P., Bava, S.V., Babu, M.S., Jinesh, G.G., 2021. Targeting K-Ras and apoptosis-driven cellular transformation in cancer. Cell Death Dis. 7, 80.
Gullulu, O., Hehlgans, S., Rodel, C., Fokas, E., Rodel, F., 2021. Tumor suppressor protein p53 and inhibitor of apoptosis proteins in colorectal cancer-A promising signaling network for therapeutic interventions. Cancers 13, 624.
Guo, F., Wang, H., Jiang, M., Yang, Q., Xiang, Q., Zhou, H., Hu, X., Hao, K., Yang, J., Cao, H., Shen, Z., 2020. TDP-43 induces EMT and promotes hepatocellular
carcinoma metastasis via activating Wnt/beta-catenin signaling pathway. Am J Cancer Res 10, 3285–3301.
Ibrahim, A., Hugerth, L.W., Hases, L., Saxena, A., Seifert, M., Thomas, Q., Gustafsson, J. A., Engstrand, L., Williams, C., 2019. Colitis-induced colorectal cancer and intestinal
epithelial estrogen receptor beta impact gut microbiota diversity. Int. J. Canc. 144, 3086–3098.
Jiao, Y., Zhou, J., Jin, Y., Yang, Y., Song, M., Zhang, L., Zhou, J., Zhang, J., 2020. Long non-coding RNA TDRKH-AS1 promotes colorectal cancer cell proliferation and invasion through the beta-catenin activated Wnt signaling pathway. Front Oncol 10, 639.
Kapitanovic, S., Cacev, T., Antica, M., Kralj, M., Cavric, G., Pavelic, K., Spaventi, R., 2006. Effect of indomethacin on E-cadherin and beta-catenin expression in HT-29
colon cancer cells. EXp. Mol. Pathol. 80, 91–96.
Liu, F., Li, L., Lu, W., Ding, Z., Huang, W., Li, Y.T., Cheng, C., Shan, W.S., Xu, J., He, W.,
Zhanghui, Yin, Z., 2020. Scutellarin ameliorates cartilage degeneration in osteoarthritis by inhibiting the Wnt/beta-catenin and MAPK signaling pathways. Int. Immunopharm. 78, 105954.

Long, L., Li, Y., Yu, S., Li, X., Hu, Y., Long, T., Wang, L., Li, W., Ye, X., Ke, Z., Xiao, H.,
2019. Scutellarin prevents angiogenesis in diabetic retinopathy by downregulating VEGF/ERK/FAK/src pathway signaling. J Diabetes Res 2019, 4875421.
Lu, Y., Wang, J., Ji, Y., Chen, K., 2019. Metabonomic variation of exopolysaccharide from rhizopus nigricans on AOM/DSS-Induced colorectal cancer in mice.
OncoTargets Ther. 12, 10023–10033.
Patra, S., Pradhan, B., Nayak, R., Behera, C., Panda, K.C., Das, S., Jena, M., Bhutia, S.K., 2021. Apoptosis and autophagy modulating dietary phytochemicals in cancer therapeutics: current evidences and future perspectives. Phytother Res., 7082
Rajabi, S., Maresca, M., Yumashev, A.V., Choopani, R., Hajimehdipoor, H., 2021. The most competent plant-derived natural products for targeting apoptosis in cancer therapy. Biomolecules 11.
Rodriguez, L.G., Wu, X., Guan, J.L., 2005. Wound-healing assay. Methods Mol. Biol. 294, 23–29.
Salim, T., Sjolander, A., Sand-Dejmek, J., 2013. Nuclear expression of glycogen synthase
kinase-3 beta and lack of membranous beta-catenin is correlated with poor survival in colon cancer. Int. J. Canc. 133, 807–815.
Sun, J.B., Li, Y., Cai, Y.F., Huang, Y., Liu, S., Yeung, P.K., Deng, M.Z., Sun, G.S.,
Zilundu, P.L., Hu, Q.S., An, R.X., Zhou, L.H., Wang, L.X., Cheng, X., 2018. Scutellarin protects oXygen/glucose-deprived astrocytes and reduces focal cerebral ischemic
injury. Neural Regen Res 13, 1396–1407.
Sun, Q., He, M., Zhang, M., Zeng, S., Chen, L., Zhou, L., Xu, H., 2020. Ursolic acid: a systematic review of its pharmacology, toXicity and rethink on its pharmacokinetics based on PK-PD model. Fitoterapia 147, 104735.
Sung, H., Ferlay, J., Siegel, R.L., Laversanne, M., Soerjomataram, I., Jemal, A., Bray, F.,
2021. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality Worldwide for 36 cancers in 185 countries. CA Cancer J Clin 71, 209–249.
Sung, N.Y., Kim, M.Y., Cho, J.Y., 2015. Scutellarein reduces inflammatory responses by inhibiting src kinase activity. KOREAN J. PHYSIOL. PHARMACOL. 19, 441–449.
Tan, L., Lei, N., He, M., Zhang, M., Sun, Q., Zeng, S., Chen, L., Zhou, L.J., Meng, X.L., Xu, H.B., 2020. Scutellarin protects against human colorectal cancer in vitro by
down regulation of hedgehog signaling pathway activity. Int. J. Pharmacol. 16, 53–62.
Tewari, D., Bawari, S., Sharma, S., DeLiberto, L.K., Bishayee, A., 2021. Targeting the crosstalk between canonical Wnt/beta-catenin and inflammatory signaling cascades: a novel strategy for cancer prevention and therapy. Pharmacol. Ther., 107876
Thaker, A.I., Shaker, A., Rao, M.S., Ciorba, M.A., 2012. Modeling colitis-associated cancer with azoXymethane (AOM) and dextran sulfate sodium (DSS). J Vis EXp 4100.
Wan, S., Tan, L., Lei, N., Shi, Y.R., He, M., Zhang, M., Zhou, L.J., Jin, L.W., Meng, X.L.,
Yang, K., Xu, H.B., 2018. Compound Bieshe Kang’ai inhibits proliferation and induces apoptosis in HCT116 human colorectal cancer cells. Trop. J. Pharmaceut. Res. 17, 2163–2168.
Wang, H., Kumar, A., Lamont, R.J., Scott, D.A., 2014. GSK3beta and the control of infectious bacterial diseases. Trends Microbiol. 22, 208–217.
Wang, L., Cho, K.B., Li, Y., Tao, G., Xie, Z., Guo, B., 2019. Long noncoding RNA (lncRNA)-Mediated competing endogenous RNA networks provide novel potential biomarkers and therapeutic targets for colorectal cancer. Int. J. Mol. Sci. 20, 5758.
Wang, Z., Li, B., Zhou, L., Yu, S., Su, Z., Song, J., Sun, Q., Sha, O., Wang, X., Jiang, W., Willert, K., Wei, L., Carson, D.A., Lu, D., 2016. Prodigiosin inhibits Wnt/beta-catenin signaling and exerts anticancer activity in breast cancer cells. Proc. Natl. Acad. Sci.
U. S. A. 113, 13150–13155.
Wei, T.T., Lin, Y.T., Tseng, R.Y., Shun, C.T., Lin, Y.C., Wu, M.S., Fang, J.M., Chen, C.C.,
2016. Prevention of colitis and colitis-associated colorectal cancer by a novel polypharmacological histone deacetylase inhibitor. Clin. Canc. Res. 22, 4158–4169.
Wen, X., Wu, Y., Awadasseid, A., Tanaka, Y., Zhang, W., 2020. New advances in canonical Wnt/beta-catenin signaling in cancer. Canc. Manag. Res. 12, 6987–6998.
Xie, Z., Guo, Z., Lei, J., Yu, J., 2019. Scutellarin synergistically enhances cisplatin effect against ovarian cancer cells through enhancing Scutellarin the ability of cisplatin binding to
DNA. Eur. J. Pharmacol. 844, 9–16.
Xiong, L.L., Du, R.L., Xue, L.L., Jiang, Y., Huang, J., Chen, L., Liu, J., Wang, T.H., 2020.
Anti-colorectal cancer effects of scutellarin revealed by genomic and proteomic analysis. Chin. Med. 15, 28.
Xu, Z., Ran, J., Gong, K., Hou, Y., Li, J., Guo, Y., 2020. LncRNA SUMO1P3 regulates the invasion, migration and cell cycle of gastric cancer cells through Wnt/beta-catenin
signaling pathway. J. Recept. Signal Transduct. Res. 1–8.
Yang, N., Zhao, Y., Wang, Z., Liu, Y., Zhang, Y., 2017. Scutellarin suppresses growth and
causes apoptosis of human colorectal cancer cells by regulating the p53 pathway. Mol. Med. Rep. 15, 929–935.
Yashiro, M., 2014. Ulcerative colitis-associated colorectal cancer. World J. Gastroenterol.
20, 16389–16397.
Zeng, Y.Q., Cui, Y.B., Gu, J.H., Liang, C., Zhou, X.F., 2018. Scutellarin mitigates abeta- induced neurotoXicity and improves behavior impairments in AD mice. Molecules 23, 869.
Zhao, H., He, M., Zhang, M., Sun, Q., Zeng, S., Chen, L., Yang, H., Liu, M., Ren, S., Meng, X., Xu, H., 2021. Colorectal cancer, gut microbiota and traditional Chinese
medicine: a systematic review. Am. J. Chin. Med. 49, 805–828.
Zhou, A., Lin, K., Zhang, S., Chen, Y., Zhang, N., Xue, J., Wang, Z., Aldape, K.D., Xie, K., Woodgett, J.R., Huang, S., 2016. Nuclear GSK3beta promotes tumorigenesis by phosphorylating KDM1A and inducing its deubiquitylation by USP22. Nat. Cell Biol.
18, 954–966.
Zhu, P.T., Mao, M., Liu, Z.G., Tao, L., Yan, B.C., 2017. Scutellarin suppresses human colorectal cancer metastasis and angiogenesis by targeting ephrinb2. Am J Transl Res 9, 5094–5104.