coli was also tested and compared to that of the wild type E col

coli was also DNA Damage inhibitor tested and compared to that of the wild type E. coli. No defect was detected (data not shown). Similar results were obtained with LB broth and M9 minimal medium, results obtained with LB broth are shown (Figure 1). Table 1 Bacterial strains,

plasmids and oligonucleotides used for mutagenesis. Bacterial strains and plasmids   Characteristics Source or reference E. coli strains K12 Isolate MG1655 Dr. Sydney Kustu, University of California   ΔarcA ΔarcA::kan derivative of K12 This study   ΔarcB ΔarcB::cm derivative of K12 This study   arcB::kan derivative of K12 in which Kanr was inserted adjacent to arcB while maintaining the function of arcB This study   ΔarcB-rev kan derivative of ΔarcB with arcB::cm Selleck Ilomastat replaced by wild type arcB This study   ΔfliC fliC non-polar deletion mutant of K12 This study   ΔarcA/ΔfliC ΔarcA::kan/ΔfliC derivative of K12 This study Plasmids pRB3-273C Apr, low to medium copy number plasmid

[40]   pRB3-arcA derivative of pRB3-273C containing arcA [38]   pRB3-arcD2A derivative of pRB3-arcA containing Asp54 → Ala mutation This study Oligonucleotides Used for Sequence arcA5KO mutagenesis of arcA 5′-tcttatcgttgaagacgagttggtaacacgcaacacgttg aaaagtattttcgaagcggagtgtaggctggagctgcttc-3′ arcA3KO mutagenesis of arcA 5′-tcttccagatcaccgcagaagcgataaccttcaccgtgaa Belnacasan order tggtggcgatgatttccggccatatgaatatcctccttag-3′ arcB5KO mutagenesis of arcB 5′-gccctcgtcgttcttgccattgtggtacaaatggcggtaaccatggtgct gcatggtcaggtcgaaagcattgatgttatgtgtaggctggagctgcttc-3′ arcB3KO mutagenesis of arcB 5′-gtggcttttgccacccacgctttcagcacttctacgtcgtgacgccactc ttctttcatctcttcaatccattcaccgaccatatgaatatcctccttag-3′ arcB-rev5 generation of

arcB::kan 5′-cacattaatttttttaataaaaatggtacgcatcacacatttaactgattcatgtaacaa atcatttaagttttgctatcttaactgcgtcatatgaatatcctccttag-3′ arcB-rev3 generation of arcB::kan 5′-gcgaatactgcgccaacaccagggaaatcttggctgcgccgtaaattattatgatga gttacaagggcacagcactgtttttcaggccgcgtgtaggctggagctgcttc-3′ Baf-A1 ic50 fliC5KO mutagenesis of fliC 5′-tcgctgatcactcaaaataatatcaacaagaaccagtctgcgctgtcgag ttctatcgagcgtctgtcttctggcttgcggtgtaggctggagctgcttc-3′ fliC3KO mutagenesis of fliC 5′-ctgcggtacctggttagcttttgccaacacggagttaccggcctgctgga tgatctgcgctttcgacatattggacacttcatatgaatatcctccttag-3′ kan, kanamycin resistance cassette; cm, chloramphenicol resistance cassette. Sequences in bold in the table indicate those that are homologous to plasmids pKD3 and pKD4 [50], which were used as PCR templates for mutagenesis. Figure 1 Resistance of the ΔarcA and ΔarcB mutant of E. coli to H 2 O 2 . (A and B) Growth and survival of wild type E. coli (diamond), ΔarcA mutant E. coli (square), ΔarcA mutant E. coli transformed with plasmid pRB3-273C (triangle) and ΔarcA mutant E. coli transformed with plasmid pRB3-arcA (cross) in LB broth with 1.5 mM H2O2 (A) or LB broth alone (B). (C and D) Growth and survival of wild type E. coli (diamond), ΔarcB mutant E. coli (square) and ΔarcB revertant mutant E. coli (cross) in LB broth with 1.5 mM H2O2 (C) or LB broth alone (D).

Comments are closed.