PCR products were isolated and cloned using the TOPO TA Cloning System (Invitrogen Corp., Carlsbad, CA, USA) [19]. Plasmid preparations were obtained using the Fast Plasmid TM Mini technology from Eppendorf (Brinkmann Instruments, Inc. Westbury, NY, USA). The 5′ and 3′ ends of the S. schenckii Gα subunit gene were obtained using SMART RACE (BD Biosciences, Clontech, Palo Alto CA, USA). All RACE reactions were carried out as described previously [19]. Erastin molecular weight Primers for RACE were designed based on the sequence obtained previously. Nested

primers were designed to improve the selleckchem original amplification reactions. Bands MM-102 from the 5′ and 3′ nested PCR, respectively, were excised from the gel, cloned and sequenced [19]. The following primers were used for 3′ RACE: GSP2A (fw) 5′ cttgaggaaagcagtcagaaccgaatgatg 3′ and GSP2C (fw) 5′ gtgaatcgggcacacctcaacttatatcct 3′. The following primers were used for 5′ RACE: GSP1E (rev) 5′ catcattcggttctgactgctttcctcaag 3′; GSP1D (rev) 5′ aaagtcgcagtacgcacggatctcatcgct 3′ and SSG-2 5 ‘UTR primer-1 (rev) 5′ tagcagtagaatcttgcattctcgccgt 3′ and SSG-2 5′ UTR primer-2 (rev) 5′ tcctcttcttctgctccacctcctcact 3′. The complete coding sequence of the ssg-2 gene from cDNA and genomic

DNA were obtained using reverse transcriptase polymerase chain reaction (RTPCR) and end to end PCR, respectively. The cDNA obtained using the RETROscript™ First Strand Synthesis kit (Ambion, Applied Biosystems, Foster City, CA, USA) was used as template. The following primers were used: MGACMS (fw)/KDSGIL (rev) primer pair. The sequence of these primers were the following: 5′ atgggggcttgcatgagt 3′ and 5′ aggataccggaatctttg

3′, respectively. For the genomic sequence PCR, DNA was used as template and the primers used Dichloromethane dehalogenase were the same as those used for RTPCR. The PCR products containing the entire coding sequence, from both the cDNA and genomic templates were cloned and sequenced. Sequencing the sspla 2 gene Polymerase chain Reaction and Genome Walker The 5′ sequence of the PLA2 homologue was obtained using a combination of PCR and Genome Walker (Clontech Laboratories Inc., Palo Alto, CA, USA). Genomic DNA was used as template for PCR. For genome walking a Pvu II library of S. schenckii genomic DNA done as described by the manufacturer was used as template for the primary specific PCR reactions using the gene specific primers (GSP) and AP1 primer. The primary PCR reactions were used as template for nested PCR using nested gene specific primers (NGSP) and AP2 primer.