The comprehensive approach taken by Cases in Pre-Hospital and Retrieval Medicine is reflected by the inclusion of a dedicated section

dealing with military aircraft in Case 50 and the detailed protocols and incident “aide memoires” contained in the Appendices. Cases in Pre-Hospital and Retrieval Medicine is essential reading for all physicians, nurses, and paramedics working full-time or part-time in retrieval medicine, whether in a coordination, operational, or management capacity. Academic and research departments of retrieval medicine should also consider this book as a required reference textbook for their libraries and graduate and postgraduate courses in aeromedical retrieval. It would also be a useful reference in the clinic for health professionals working in travel and expedition High Content Screening medicine, who require some insight into this discipline. This First Edition AZD4547 of Cases in Pre-Hospital and Retrieval Medicine is a significant development in a quite limited field

of textbooks in retrieval medicine, authored by two retrieval physicians with impeccable credentials. “
“Many studies have explored the risk perception of frequent business travelers (FBT) toward malaria. However, less is known about their knowledge of other infectious diseases. This study aimed to identify knowledge gaps by determining the risk perception of FBT toward 11 infectious diseases. Our retrospective web-based survey assessed the accuracy of risk perception learn more among a defined cohort of FBT for 11 infectious diseases. We used logistic regression and the chi-square test to determine the association of risk perception with source of travel advice, demographic variables, and features of trip preparation. Surveys were returned by 63% of the 608 self-registered FBT in Rijswijk, and only the 328 completed questionnaires that adhered to our inclusion criteria were used for analysis. The majority (71%) sought pre-travel health advice and used a company health

source (83%). Participants seeking company travel health advice instead of external had significantly more accurate risk knowledge (p = 0.03), but more frequently overestimated typhoid risk (odds ratio = 2.03; 95% confidence interval = 1.23–3.34). While underestimation of disease risk was on average 23% more common than overestimation, HIV risk was overestimated by 75% of FBT. More accurate knowledge among FBT seeking company health advice demonstrates that access to in-company travel clinics can improve risk perception. However, there is an obvious need for risk knowledge improvement, given the overall underestimation of risk. The substantial overestimation of HIV risk is probably due to both public and in-company awareness efforts.

The comprehensive approach taken by Cases in Pre-Hospital and Retrieval Medicine is reflected by the inclusion of a dedicated section

dealing with military aircraft in Case 50 and the detailed protocols and incident “aide memoires” contained in the Appendices. Cases in Pre-Hospital and Retrieval Medicine is essential reading for all physicians, nurses, and paramedics working full-time or part-time in retrieval medicine, whether in a coordination, operational, or management capacity. Academic and research departments of retrieval medicine should also consider this book as a required reference textbook for their libraries and graduate and postgraduate courses in aeromedical retrieval. It would also be a useful reference in the clinic for health professionals working in travel and expedition BIBW2992 nmr medicine, who require some insight into this discipline. This First Edition CHIR99021 of Cases in Pre-Hospital and Retrieval Medicine is a significant development in a quite limited field

of textbooks in retrieval medicine, authored by two retrieval physicians with impeccable credentials. “
“Many studies have explored the risk perception of frequent business travelers (FBT) toward malaria. However, less is known about their knowledge of other infectious diseases. This study aimed to identify knowledge gaps by determining the risk perception of FBT toward 11 infectious diseases. Our retrospective web-based survey assessed the accuracy of risk perception Avelestat (AZD9668) among a defined cohort of FBT for 11 infectious diseases. We used logistic regression and the chi-square test to determine the association of risk perception with source of travel advice, demographic variables, and features of trip preparation. Surveys were returned by 63% of the 608 self-registered FBT in Rijswijk, and only the 328 completed questionnaires that adhered to our inclusion criteria were used for analysis. The majority (71%) sought pre-travel health advice and used a company health

source (83%). Participants seeking company travel health advice instead of external had significantly more accurate risk knowledge (p = 0.03), but more frequently overestimated typhoid risk (odds ratio = 2.03; 95% confidence interval = 1.23–3.34). While underestimation of disease risk was on average 23% more common than overestimation, HIV risk was overestimated by 75% of FBT. More accurate knowledge among FBT seeking company health advice demonstrates that access to in-company travel clinics can improve risk perception. However, there is an obvious need for risk knowledge improvement, given the overall underestimation of risk. The substantial overestimation of HIV risk is probably due to both public and in-company awareness efforts.

gambiae. Cry2Aa is a rare insecticidal protein with dual activity towards lepidopteran (moths and butterflies) (Crickmore et al., 1998) and dipteran (mosquitoes) insects (Widner & Whiteley, 1989). Reported dipteran targets of Cry2Aa include Aedes aegypti and Anopheles gambiae,

which are potential mosquito vectors of yellow fever and malaria, respectively. Although Cry2Aa and Cry2Ab display 87% structural conservation, Cry2Ab has been reported as demonstrating only lepidopteran activity (Hofte & Whiteley, 1989; Widner & Whiteley, 1989; Dankocsik et al., 1990; Morse et al., 2001). Previous attempts were made to introduce mosquitocidal activity against Ae. aegypti through chimeric-scanning mutagenesis of Cry2Ab for Cry2Aa residues 307–382 (Liang & Dean, 1994). Domain II of Cry2Aa protein is comprised of the lepidopteran- (L) buy Dabrafenib and dipteran (D)-specific regions. click here Residues 341–412 are described as the L block, while the D block consists of residues 307–340 (Widner & Whiteley, 1990). Of 106 residues, only 23 differ between Cry2Aa and Cry2Ab, which are putatively responsible for the differential specificity displayed by the Cry2A toxins.

Only nine residues, located within the D block, confer specificity to dipteran insects. An epitope was proposed for Cry2Aa toxin binding to the receptor (Morse et al., 2001). Sequence alignment of cry2Aa and cry2Ab DNA was performed with clustalw2 internet-based software (http://www.ebi.ac.uk/Tools/msa/clustalw2/). To generate a model for Cry2Ab, the following programs were utilized: Glutamate dehydrogenase (i) internet-based software swiss-model (http://swissmodel.expasy.org/); (ii) pymol viewer v0.98 (DeLano Scientific LLC, 2005). fasta protein sequences of

Cry2Aa and Cry2Ab were entered into swiss-model Workspace Modelling-Automated Mode. A work unit with a modelled tertiary structure for Cry2Ab was generated based on the template PDB file 1i5pA. Pdb file of Cry2Ab model was downloaded and viewed with pymol viewer (Fig. 1). DEC297 strain with the cry2Ab gene was from our laboratory stocks, which was originally obtained from Dr Bill Donovan (Ecogen, Inc.) as E67219 (HD73-26 cry−), containing plasmid pEG259 (Dankocsik et al., 1990). Primers (Sigma) were designed (2Ab_startNdeIFwd: CCCTGGCATATGAGGAGGAATTTTATATGAA TAG & 2Ab_endXhoIRev: CCCGAACTCGAGGAATAAAAATAAAGAGG TTGCCTC), and cry2Ab was cloned out of DEC297. Clontech In-fusion™ method was used for cloning work. Clontech software was used to design In-fusion primers (Sigma) (2Ab_startNdeIFwd infusion1: AAGGAGATATACATATGA GGAGGAATTTTATATGAATAG & 2Ab_endXhoIRev infusion2: GGTGGTGGTGCTCGAGGAATAAAAAT AAAGAGGTTGCCTC). Primers (Sigma) were designed (2Ab_startNdeIFwd: CCCTGGCATATGAGGAGGAATTTTATATGAA TAG & 2Ab_endXhoIRev: CCCGAACTCGAGGAATAAAAATAAAGAGGTTGCCTC) and cry2Ab was cloned out of pNN101 in Bacillus thuringiensis (Dankocsik et al., 1990). Clontech In-fusion™ method was used for cloning work.

Each plate contained the test strain with the plasmid pET26b+ or with the plasmid pETSN as a control. The selected transformants were cultured in LB medium containing 30 μg mL−1 kanamycin at 37 °C. IPTG was added to the medium at a final concentration of 0.7 mM to induce bacteria when the OD600 nm reached approximately 0.8 (Liang et al., 2007). After further induction overnight at 20 °C, cells were harvested by centrifugation, resuspended and then disrupted by sonication on ice. The supernatant of the whole-cell extracts was purified using the Ni-NTA column (Invitrogen) and DEAE Sepharose Fast Flow column

(Amersham Biosciences) according to the manufacturers’ instructions. The purification was performed at 0–4 °C. After the purification, the molecular mass of the purified enzymes was analyzed by SDS-PAGE using Nutlin-3a nmr a 12.5% (w/v) polyacrylamide separating gel. The protein concentration was determined

using the BCA protein assay reagent kit (Pierce). For immunoblotting, the proteins separated by SDS-PAGE were electrically transferred onto a polyvinylidene difluoride membrane. The membrane was blocked overnight at 4 °C in the blocking buffer (5% skim milk) and then incubated for 2 h at 37 °C with 1 : 3000 diluted mouse anti-His-tag monoclonal antibody, followed by incubation for 1 h at 37 °C with 1 : 6000 diluted HRP-Goat anti-mouse IgG (H + L) (Genscript, Nanjing, China). Finally, bands were visualized using enhanced chemiluminescence AZD6244 Western blotting detection reagents (Millipore). Fibrinolytic activity was determined by measuring the areas of the lysed zone on the fibrin plate (Astrup & Mullertz, 1952; Liang et al., 2007). In brief, the fibrin plate was made up of 0.4% fibrinogen, 0.6% agarose and 0.5 U mL−1 thrombin, which were dissolved in 50 mM barbitol buffer (pH 7.8) beforehand and mixed in a petri dish (9 cm in diameter). Purified enzymes were also diluted using the 50 mM barbitol buffer, and 20 μL of the samples were placed into holes which had been made previously on the fibrin plate. After measuring the dimension of the clear zone and oxyclozanide incubating

the plate at 37 °C for 18 h, the fibrinolytic activity was estimated using urokinase as a standard. The specific activity of the enzyme to hydrolyze fibrin was defined as urokinase units of fibrinolytic activity in each milligram of enzyme. Enzymatic kinetics were determined by measuring the release of p-nitroaniline from the chromogenic substrate suc-AAPF-pNA in 100 mM phosphate buffer (pH 8.0) containing 4% (v/v) DMSO at (37 °C ± 0.2) (Sumi et al., 1987). After incubation for 10 min at 37 ± 0.2 °C, the concentration of liberated p-nitroaniline was measured at an absorbance of 405 nm using an automatic microplate reader (Thermo Lab systems, Multiskan MK3). Kinetic parameters (Vmax and Km) were determined from initial rate measurements at different substrate concentrations ranging from 0.098 to 0.392 mM.

For P1sarA, the phosphorylation of SarA by Stk1 (Fig. 3d), and, to a lesser extent, by SA0077 (data not shown) led to a delayed shift [2 and 0.8 μg required, respectively, for a complete shift vs. 0.5 μg when SarA is not phosphorylated (Fig. 3c)]. Concerning PfnbA and Prot, phosphorylation of SarA by SA0077 induced a delayed shift (Fig. 4b and d) compared with the unphosphorylated SarA conditions (Fig. 4a and c), whereas phosphorylation by Stk1 had no effect (data not shown). SarA was also incubated with Stk1-K39 and SA0077-K152, two mutants that are unable to autophosphorylate, and thus, are unable to phosphorylate

any substrate. As expected, no difference was observed between unphosphorylated SarA and SarA incubated with each of these two mutant kinases, showing that neither Stk1 nor SA0077 interacts with the different promoters tested. The main result of this study CHIR-99021 cost is the demonstration, for the first time, that the S. aureus virulence regulator SarA is phosphorylated both in vivo and in vitro. SarA is a global transcriptional regulator of numerous virulence determinants produced by S. aureus (Wolz et al., 2000; Cheung et al., 2004, 2008b), which is expressed constitutively (Bayer et al., 1996; Manna et al., 1998; Blevins et al., 1999). SarA activates Fnb expression during the check details exponential growth phase.

These data suggest that SarA is mainly activated in early growth. Wolz et al. (2000) hypothesized that a post-translational modification of SarA may occur during various stages of

the growth cycle. It would therefore be interesting to know in which growth phase Stk1 or SA0077 is expressed. Although SarA regulates virulence genes in a growth-phase-dependent manner, especially in the late exponential phase and in the beginning of the stationary phase, still the intracellular amount of SarA remains constant throughout growth (Blevins et al., 1999). In any case, the mechanism that controls its own activity remains to be determined. In this regard, two different hypotheses have been proposed recently, suggesting that SarA activity is controlled by either its binding to some specific protein or its post-translational modification (Blevins et al., 1999; Wolz et al., 2000; Schumacher et al., 2001; BCKDHB Bronner et al., 2004). Our data support the latter hypothesis by showing that SarA is phosphorylated in vivo. Furthermore, it is unable to autophosphorylate, but can be intensely phosphorylated in vitro by both Stk1, mainly at threonine residues, and SA0077, mainly at serine residues. These results strongly suggest that there exists a tight and selective regulation of SarA by phosphorylation catalyzed by both Ser/Thr kinases of S. aureus. MS was used to determine the phosphorylated sites on SarA, but no significant result could be obtained. However, phosphorylation on seryl residues by SA0077 led to a decreased ability of SarA to bind DNA.

TyphimuriumS and S. TyphimuriumR (Fig. 2). The relative gene expression levels of hilA and lpfE were increased in the planktonic cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 5.5 after 48-h incubation (Fig. 2a). The highest expression level (46.4-fold) was observed at the lpfE gene in S. TyphimuriumR grown in TSB at pH 5.5. The relative gene expression levels were higher in S. TyphimuriumR than in S. TyphimuriumS. The relative expression levels of acrB and tolC genes were increased 1.8- and

1.5-fold, respectively, in S. TyphimuriumR (Fig. 2a). TGF-beta inhibitor As shown in Fig. 2b, the relative gene expression levels of hilA and lpfE were increased more than fivefold in the planktonic cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 7.3 after 48-h incubation. The greatest changes in gene expression, 18.8- and 18.1-fold, were observed at the lpfE gene in S. TyphimuriumS and S. TyphimuriumR, respectively. The relative expression levels of acrB, filmA, invA, and tolC genes were increased 2.3-, 2.9-, 1.8-, and 1.4-fold, respectively, in S. TyphimuriumS grown in TSB at pH 7.3. Quizartinib Similar to the planktonic cells, the relative expression of lpfE gene was increased more

than twofold in the biofilm cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 5.5 after 48-h incubation (Fig. 2c). The relative expression level of hilA gene was increased 1.1-fold in the biofilm cells of S. TyphimuriumR at pH 5.5. As shown in Fig. 2d, the acrA, acrB, lpfE, stn, and tolC genes were stable

in the biofilm cells of both S. TyphimuriumS and S. TyphimuriumR grown in TSB at pH 7.3. The relative expression levels of all genes were increased in the biofilm cells of S. TyphimuriumS PRKACG grown in TSB at pH 7.3, except for the ompD gene (Fig. 2d). This study describes the gene expression dynamics of planktonic and biofilm-associated foodborne pathogens with multiple antibiotic resistance profiles when grown at different acidic pH ranges under anaerobic conditions. As antibiotic resistance is one of the major public health problems worldwide, this study sheds light on new approaches to the understanding of virulence properties of antibiotic-resistant pathogens exposed to stress conditions. The antibiotic-resistant strains S. aureusR and S. TyphimuriumR grew well in TSB at pH 5.5 compared to the antibiotic-susceptible strains (Table 3), suggesting that the antibiotic-resistant strains can adapt better to acidic conditions than the antibiotic-susceptible strains can. The acid-adapted cells provide cross-protection against heat, pH, osmolarity, and antibiotics (Leyer & Johnson, 1993; Lee et al., 1994; Greenacre & Brocklehurst, 2006). The biofilm formation by antibiotic-susceptible strains (S. aureusS and S. TyphimuriumS) was significantly inhibited by pH 5.5 compared to the antibiotic-resistant strains (S.

The mobile phase A contained 2% acetonitrile in water, 0.1% formic acid. The organic phase B contained 2% water in acetonitrile with 0.1% formic acid. Peptides were eluted

with a linear gradient of a 5–60% mobile check details phase B over 60 min at 0.2 μL min−1. Spectra were acquired in the automated mode using Information Dependent Acquisition. Precursor ions were selected in Q1 using the enhanced MS (EMS) mode as a survey scan. The EMS was followed by an enhanced resolution scan of the three most intense ions at a low speed of 250 AMU s−1 to determine the ion charge states and then by an enhanced product ion scan. The precursor ions were fragmented by collisionally activated dissociation in the Q2 collision cell. The fragment ions generated were captured and mass analyzed in the Q3 linear ion trap. Protein identifications Smad inhibitor were obtained from the MS/MS spectra data sets using mascot (version 1.6b9, Matrix Science, London, UK, available at http://www.matrixscience.com). Mass tolerances of 0.5 Da for the precursor and 0.3 Da for the fragment ion masses were used. Carbamidomethyl-cysteine was the fixed modification and one missed cleavage for trypsin was allowed. Searches were conducted using the Bacteria subset of the NCBInr database (http://www.ncbi.nih.gov). Wild-type V. shilonii AK-1 cells were taken directly from swimming plates at different soft agar concentrations

and suspended in 10 mM HEPES buffer, pH 8.0. Cell samples were stained negatively with 1% uranyl acetate, isolated hook–basal bodies (HBB) were stained with 2% ammonium hepta-molibdate, pH 8.0, and observed using a JEM-1200EXII electron microscope (JEOL, Tokyo, Japan). Micrographs were taken at an accelerating voltage of 80 and 120 kV for cells and HBB, respectively. Vibrio shilonii displays a constitutive single-sheathed polar flagellum when grown in a liquid Metalloexopeptidase medium. Figure 1a shows an electron micrograph of a typical swimmer bacterial cell grown in a liquid culture. We tested the effect of amiloride, a sodium channel blocker, on the ability of this marine bacterium to swim on soft agar plates (0.3% agar).

Figure 1b shows that in the presence of 2 mM amiloride dissolved in 2% DMSO, the swimming capacity of V. shilonii in soft agar plates is diminished as compared with cells swimming under the same conditions in the absence of amiloride. Consistent with this result, we detected that amiloride reduces swimming drastically in cells growing in liquid cultures that were observed using high-intensity dark-field microscopy. The effect of amiloride on the growth rate of V. shilonii in liquid cultures was also tested. Figure 1c shows that the growth rate of control cells is indistinguishable from a culture to which a volume of 2% DMSO was added. However, in the presence of 2 mM amiloride, a slight decrease in the growth rate of V. shilonii that recovers after a few hours was observed.

[6-8] In the United States, as the prognosis of multiple cancer types has improved over the past few decades,[9] more persons living with cancer

are enjoying a better quality of life which includes increased mobility and the ability to travel. In the past decade, other studies have evaluated international travel, exposure risks, and travel-related illnesses among specific groups of immunocompromised travelers, such as those infected with HIV and solid organ transplant (SOT) recipients.[10-14] However, international travel patterns and exposure risks among immunocompromised travelers diagnosed with cancer remain to be described. The purpose of this study was to describe and compare the international travel patterns, infectious diseases exposure risks, pre-travel http://www.selleckchem.com/products/SGI-1776.html interventions, and travel-related illnesses among both immunocompromised and immunocompetent patients with a history of cancer. This was a retrospective cohort study of all patients who obtained pre-travel counseling at the travel clinic at Memorial Sloan-Kettering Cancer Center (MSKCC), a tertiary care cancer center, between January 1, 2003 and June 30, 2011. Travelers who were diagnosed with cancer or underwent stem cell transplantation (SCT) were included in the study. Travelers with carcinoma in situ or nonmelanoma skin cancer were excluded. Demographic information, comprehensive

Anti-diabetic Compound Library research buy cancer history, current medications, pertinent laboratory tests and radiological reports, and immunization history were obtained from the medical record. Information regarding detailed trip itinerary, departure date, length of stay, and purpose of travel, vaccinations, and malaria prophylaxis was obtained from the pre-travel encounter visit. The first follow-up visit with the oncologist after MycoClean Mycoplasma Removal Kit return from travel was reviewed to determine the presence of any reports of travel-related illness. Charts were also reviewed to

determine if death within 1 year of a pre-travel health visit occurred, and if so, cause of death was extracted. Using the Centers for Disease Control and Prevention (CDC) travel guidelines,[15] travelers were classified as immunocompromised if their immune status was impaired at the time of the pre-travel visit. This immunocompromised group included travelers who had received radiation therapy and/or immunosuppressive chemotherapy within the past 3 months prior to the pre-travel visit or who had undergone SCT within the past 2 years prior to the pre-travel visit. Travelers with active leukemia or lymphoma, generalized metastatic solid malignancies, active graft-versus-host disease (GVHD), history of splenectomy, and/or travelers who had received treatment in which immunosuppressive effects lasted more than 3 months as evidenced by laboratory abnormalities including a low absolute neutrophil count or T-cell repertoire, were also classified as immunocompromised.

Beyond the antennal lobe we observed astrocyte-like glial spontaneous

calcium activities in the ventromedial protocerebrum, indicating that astrocyte-like glial spontaneous calcium elevations might be general in the adult fly brain. Overall, our study demonstrates a new function for astrocyte-like glial cells in the physiological modulation of olfactory information transmission, possibly through regulating ORN–PN synapse strength. “
“In many retinal diseases, it is the death of photoreceptors that leads to blindness. In previous in vitro and in vivo studies, basic fibroblast growth factor (bFGF) has been shown to increase retinal cell survival. More recently, reactive oxygen species (ROS) have also been shown to promote cell survival, contrary to the traditional view that they are solely destructive molecules. Due to this possible link, this website we hypothesised that bFGF could stimulate the production

of ROS, which in turn stimulates the protein kinase B (Akt) survival pathway. Flow cytometry was used to measure the fluorescence of oxidised dihydrorhodamine, a ROS indicator, in the murine 661W photoreceptor cell line under several different conditions. Expression of cyclooxygenase (Cox) enzymes was evaluated by immunohistochemistry, and the response of photoreceptor cells to exogenous bFGF in the explanted mouse retina was studied by confocal microscopy. Exogenous addition of bFGF to 661W cells resulted in an increase in ROS production that lasted for 24 h. When this ROS production was inhibited, Phenylethanolamine N-methyltransferase bFGF-induced phosphorylation of Akt was prevented. Through the use of inhibitors and BIBW2992 order small interfering RNA in the cell line, the source of this production was shown to be Cox and to involve the activation of phospholipases A2 + C. This pathway may also occur in the mouse retina, as we showed that the retina expressed Cox1&2, and that photoreceptors in explanted retina respond to bFGF by increasing their ROS levels. These results demonstrate that exogenous bFGF can stimulate ROS production

through the activation of Cox, and activate the Akt pathway. “
“Amyloid beta (Aβ), a key component in the pathophysiology of Alzheimer’s disease, is thought to target excitatory synapses early in the disease. However, the mechanism by which Aβ weakens synapses is not well understood. Here we showed that the PDZ domain protein, protein interacting with C kinase 1 (PICK1), was required for Aβ to weaken synapses. In mice lacking PICK1, elevations of Aβ failed to depress synaptic transmission in cultured brain slices. In dissociated cultured neurons, Aβ failed to reduce surface α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor subunit 2, a subunit of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors that binds with PICK1 through a PDZ ligand–domain interaction.

Notably, our study revealed that the F1 subtype was highly predominant (with a frequency of almost 50%) among European patients carrying non-B subtypes, more than 80% of whom were Italians. Specifically, this clade, which has a high prevalence in South America [27] and to some

extent in Eastern Europe [28], was found to be significantly Seliciclib purchase associated with the heterosexual route of transmission. This novel finding warrants further investigation, either through collection of information on sexual behaviour or by using phylogenetic approaches to trace the probable origin of these infections. These data will be of value in the development of public health interventions. An unusually high proportion (about 10%) of URFs among non-B subtypes were detected in Caucasian and in African and Latin American individuals. This might have been a result of the high accuracy of the phylogenetic and recombination analysis. Indeed, two types of URF were detected in three patients each, making these forms novel CRF candidates to be further characterized by full-length sequencing. URFs with a B/F pattern were found at a disproportionately high rate (>30%), supporting the results of previous studies in which these two clades were found to have a high propensity to recombine [27,29]. Further spread of such recombinants may lead to overlapping Selleck Ipilimumab epidemics, such

that the landscape of HIV-1 diversity in Italy may in future be distinct from that of the rest of Europe. Our methodological approach had some limitations.

Thymidine kinase First, the duration of residence in Italy was not available for immigrants with known countries of origin. Thus, they may have acquired the infection in their country of origin or later in Italy. Similarly, no information about travel was recorded for Italian patients. Secondly, the number of individuals with a known seroconversion date was too small to allow this to be used to determine the date of entry of non-B clades into Italy. Therefore, we used the date of the first HIV-1-positive test as a surrogate for the duration of infection, which is an exceedingly conservative approach; it is probable that entry of non-B clades into Italy and increases in their circulation actually occurred earlier than suggested by our estimates. The increasing proportion of patients presenting late with AIDS further supports this hypothesis, as these patients are diagnosed several years following the acquisition of infection. A third caveat concerns the use of pol sequences for subtype assignment. It is widely accepted that this viral region, encompassing about 1000 nucleotides, is appropriate for use in tracing epidemiological trends in HIV-1-infected patient populations [19,20]. Nonetheless, subtyping using the pol gene does not rule out the possibility that other genome regions may belong to different subtypes [30]. The analysis of a limited portion of HIV-1 gene (e.g.